Search In this Thesis
   Search In this Thesis  
العنوان
Detection of Human Cytomegalovirus in the tumoral tissue of patients with colorectal cancer in Alexandria/
المؤلف
Ragab, Mahinour Mohammed AbdelFadeel.
هيئة الاعداد
باحث / ماهينور محمد عبدالفضيل رجب
مشرف / أميرة فتحي عامر
مشرف / مي محب الدين محمد رؤوف
مشرف / أحمد عبد الفتاح صبري
مناقش / عبير عبد الرحيم غزال
الموضوع
Microbiology. Immunology.
تاريخ النشر
2023.
عدد الصفحات
65 p. :
اللغة
الإنجليزية
الدرجة
ماجستير
التخصص
علم المناعة والحساسية
تاريخ الإجازة
13/7/2023
مكان الإجازة
جامعة الاسكندريه - كلية الطب - Medical Basic Sciences in Medical Microbiology and Immunology
الفهرس
Only 14 pages are availabe for public view

from 80

from 80

Abstract

Human cytomegalovirus (HCMV), the immensely pertinent betaherpesvirus has been proposed to be an oncomodulatory virus implicated in the pathogenesis of various tumours including colorectal cancer (CRC). CRC is the world’s third most common malignant disease and the second leading cause of mortality. Various factors are proposed to contribute to its pathogenesis including HCMV.
The study aimed to detect the presence of HCMV DNA and Immediate early and early proteins in CRC tissue compared to matched ANNT and correlate the tumoural presence of HCMV with the other clinicopathological features of the disease.
A prospective study was carried out on 50 patients with CRC admitted to the General Surgery Department in Alexandria Main University Hospital during the period from December 2020 to May 2022. All were subjected to full history taking, radiological and clinical assessment. They signed an informed consent after emphasizing their fulfillment to the inclusion criteria of the study. A pair of pathologically proven tumorous and ANNT was obtained from each patient and subjected to routine histopathological processing. Molecular detection of HCMV was done by conventional PCR and two primers were selected from the highly conserved regions of the genome:
 The downstream primer: (3’ ACGACCCGTGGTCATCTTTA 5’).
 The upstream primer: (5’ GCGGTGGTTGCCCAACAGGA 3’).
A band of 94 base pairs (bp) was considered positive for HCMV.
The paired samples were subjected to Immunohistochemistry using monoclonal antibodies: anti-CMV (CH2 and DDG), that react specifically with a 76 kDa HCMV early protein and an immediate early DNA binding protein p52.
Among the 50 studied patients with colorectal cancer, 18 patients (36%) were above 60, with a gender distribution of 15 males and 35 females. More than half of the studied population had sigmoid colon involvement. Moreover, adenocarcinoma histological type prevailed, constituting 92% of the tumorous samples. Grade 2 moderately differentiated tumours were the commonest representing 62% of the tumoural samples obtained.
HCMV was significantly detected in the tumorous versus the ANNT via PCR. HCMV was detected by in 32 (64%) specimens, while only 13 (26%) specimens of adjacent non-neoplastic tissue demonstrated a positive result (p < 0.001). Similarly IHC released a result delineating a significant detection of the virus in tumorous versus ANNT (p < 0.001). A moderate agreement existed between PCR and IHC regarding HCMV detection analyzed via Kappa coefficient analysis Kappa =0.572 P<0.001*.
Univariate analysis denoted a significant relationship between HCMV detection in elderly patients, CRC higher stages and nodal involvement.
Nevertheless, via the multivariate analysis, only, CRC higher stages and nodal involvement retained significance.
The detection of HCMV DNA and proteins in CRC tissue at a significantly higher rate compared to ANNT and its association with a higher tumour stage and nodal involvement supports the proposed role of this virus in the pathogenesis of CRC.