الفهرس 
IntroductionOnly 14 pages are availabe for public view
 |  | from | 163 |  |  |
| | | from | 163 | | |
Abstract
The present work was carried out at Faculty of veterinary medicine, Menoufia University, Sadate branch.
Four Egyptian goats breeds (Baladi, Zaraibi, Damascus and Alpine) were used in this study. These breeds were obtained from Sakha, animal production research station, animal production research institute, ministry of agriculture; Kafer Elsheikh .Blood samples were collected from each breed for DNA extraction to evaluate genetic variation and relatedness of goat breeds by Random Amplified Polymorphic DNA (RAPD) technique and detect polymorphism in BMPR IB gene in goat breeds (Baladi, Zaraibi, Damascus and Alpine) by detects the association between these variation and litter size, kid’s growth after birth using.
1-Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP).
2-Single Nucleotide Polymorphism (SNP) using DNA sequence analysis.
I-Evaluate genetic variation and relatedness of goat breeds by
Random Amplified Polymorphic DNA (RAPD) technique.
RAPD primers under study can be used for identifications of different goat’s breeds. Primer number1 (5’-CCGCGCCGGT-3’), Primer number 2 (5’-CAGCCTCGGC-3’), Primer number4 (5’- GCTGCTCGAG -3’), Primer number6 (5’- TCGCGAGCTG -3’), primer number 9 (AGTGCTTTCAAGGTCCATGC) and Primer number 15 (AGTCACCCAAAAGTAACTGG) produced specific bands for Alpine breeds. Primer number5 (5’- GCTAGCTACG -3’) and primer number 11 (TCCAAACAAGTCTTCTCTATTTACC) produced specific bands for Baladi breed. Primer number10 (CCTGAGTGTTCCTCCTGAGT) produced specific bands for Zaraibi breed, Primer number12 (AATGGATGACTCCTGCATGG) produced specific bands for Damascus breed.
The sum of amplified fragments for all primers were 93 bands, the highest number of amplified RAPD fragments were 72 bands in Baladi, 68 bands in Zaraibi, 67 bands in Damascus and 55 bands for Alpine.
RAPD analysis showed genetic similarity among the four goat’s breeds as: 76% (Baladi x Damascus), 74% (Baladi x Zarabi), 57% (Baladix Alpine), and 67% (Damascus x alpine), 70% (Zaraibi x Damascus) and 69% (Alpine x Zaraibi). However, the closer proximity or the highest genetic similarity was observed between Baladi and Damascus (76%), while the lowest was observed between Baladi and Alpine (57%).
The result of the present study revealed the effectiveness of RAPD markers in detecting enough polymorphism between goat’s breeds to determine their genetic relationships. Furthermore, the RAPD technique can be used as supporting marker for taxonomic identification in goats. The alpine goats breed was the most divergent genotype from all other genotypes. These wide variations of Alpine breed allow for future research to improve goats breeding in Egypt. (BMPR-IB) gene polymorphism, litter size and kids growth.
Also, the present investigation had been carried out for revealing association between bone morphogenetic protein receptor IB gene (BMPR IB) polymorphism in goat’s breeds.
The genomic DNA from 44 goats was used to amplify bone morphogenetic protein receptor IB gene (BMPR IB) which yield a fragment of 190 bp.
Restriction analysis of PCR-RFLP with AvaII and Hid III of bone morphogenetic protein receptor IB gene (BMPR IB) (190-bp) not produced restriction fragments.